Skip to content

Overexpression of satellite RNAs in heterochromatin induces chromosomal instability and reflects drug sensitivity in mouse cancer cells.

Major satellite

.

Cell culture and generation of satellite RNA-overexpressing cells

We obtained murine colon cancer MC38 cells from Kerafast (Boston, MA, USA) and CT26 (CRL-2639) cells from the American Type Culture Collection (Manassas, VA, USA). HEK293T cells cloned based on their high transfection efficiency were kindly gifted by Professor Hiroshi Itoh, Nara Institute of Science and Technology. MC38 and HEK293T cells were maintained in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 100 U/mL penicillin, and 100 mL streptomycin. CT26 cells were maintained in Roswell Park Memorial Institute-1640 medium supplemented with 10% FBS, 2 mM glutamine, 100 U/mL penicillin, and 100 mL streptomycin. All cells were cultured at 37 °C in a 5% COtwo atmosphere. The plasmid vector p156RRL-EF1a-GFPU3H1MajSat (#41796; Addgene, Watertown, MA, USA) was a gift from Inder Verma and has been previously described13.

To investigate whether the overexpression of major satellite RNA reflects drug sensitivity, we constructed retroviral control vectors and vectors expressing mSAT (Supplementary Fig. 1). cDNA of elongation factor 1α (EF1α), the SV40 polyA signal, and major satellites were amplified using polymerase chain reaction (PCR) with PrimeSTAR GXL DNA polymerase (Takara Bio, Shiga, Japan) and inserted into the EcoRI and SaltI sites of the MSCV-Pure retroviral vector. To prepare the control vector, only EF1α and the SV40 polyA signal were inserted into the said sites of the MCSV puroviral retroviral vector.

To obtain retroviruses, retroviral vectors expressing mSATs and control sequences were transfected into HEK293T cells (1 × 106 cells/60-mm-diameter culture dish), along with helpers, such as pE-Eco and pGP (Takara Bio). After 24 h, the culture medium was replaced with 1.5 mL of fresh culture medium. Secreted retroviruses were harvested every 4 h during the 24- to 60-h post-transfection period, pooled, and stored on ice. Exponentially growing cells (1 × 105 cells/60-mm-diameter culture dish) were infected with 2 mL of virus-containing conditioned medium, along with 1.0 μg/mL polybrene (Merck Millipore, Billerica, MA, USA). After 24 h, the infected cells were cultured in complete medium containing suitable concentrations of puromycin (6 μg/mL for CT26 cells; 4.5 μg/mL for MC38 cells) for 3 days, after which selected cells were used for the subsequent experiments.

RNA extraction and quantitative reverse transcription (qRT)-PCR

Total RNA was extracted using TRIzol reagent (Life Technologies; Thermo Fisher Scientific, Waltham, MA, USA). To synthesize the single-stranded cDNA, 2 μg of total RNA was added to a 20-μL reaction mixture containing 100 U ReverTra Ace, 1 mM dNTPs, and 5 pmol oligo(dT)twenty primer (TOYOBO, Osaka, Japan), followed by cDNA synthesis for 60 min at 42 °C. The reaction was terminated by heating at 95 °C for 5 min and diluted with 80 μL TE buffer. Synthesized cDNA (1 µL) was then used for quantitative PCR in a 20-μL volume using the KAPA SYBR Fast qPCR kit (KAPA Biosystems, Wilmington, MA, USA), with the reaction subsequently analyzed using a LightCycler 96 system (Roche Diagnostics, Basel, Switzerland). The PCR primer sequences were used: ubiquitin forward, GGAAGGCATTCCTCCTGAT and reverse, CCCACCTCTGAGACGGAGTA; and major satellite forward, GGCGAGAAAACTGAAAATCACG and reverse, CTTGCCATATTCCACGTCCT.

Cell proliferation and soft agar colony formation assay

Cells were seeded at 5 × 104 cells/60-mm-diameter dish and counted on days 2 and 4. For the colony formation assay, cells were seeded onto soft agar at 1 × 104 cells/35-mm-diameter dish and grown for 2 to 3 weeks. Visible colonies with a diameter of ≥ 1.0 mm were counted using Image J software (NIH, Bethesda, MD, USA; freely provided by Dr. Wayne Rasband: https://imagej.nih.gov/ij/), with the results shown as a graph.

Immunocytochemistry

Cells were cultured on cover glasses in well plates. The prepared cover glasses were fixed in 4% paraformaldehyde/phosphate-buffered saline (PBS) at 25 °C for 15 min and washed three times with PBS. The cells were permeabilized and blocked with 0.3% Triton X-100 (Agilent Technologies, Santa Clara, CA, USA) and blocked with 5% FBS at room temperature for 60 min. The cells were then washed three times with PBS and incubated with anti-α-tubulin (1:1000 #T6199 Sigma Aldrich, St Luis, Missouri, USA) and anti-γH2AX (1:500 #2578 Cell signaling Technology, Danvers, MA , USA) at 4 °C overnight. After extensive washing with PBS, the samples were incubated with Alexa-594-conjugated goat anti-mouse IgG secondary antibody (1:500 #A11001 Life technologies,) and Alexa-488-conjugated anti-rabbit IgG secondary antibody (1:500 # A11072 Life technologies) at 25 °C for 60 min. The cover glasses were washed three times with PBS, mounted in VECRASHELD Mounting medium for fluorescence (Vector Laboratories, Inc Burlingame, CA), and sealed with nail polish. Images were acquired using OLYMPUS FSX 100 fluorescence microscope (OLYMPUS, Tokyo, Japan).

Drug sensitivity and WST-1 assay

Cells were seeded in microplates (96 wells) at a concentration of 5 × 104 cells/well and 100 μL of culture medium and incubated for 24 h at 37 °C with 5% COtwo. Irinotecan (CPT; I6932; Funakoshi, Tokyo, Japan) was dissolved in DMSO and added to the medium (to final concentrations of 0, 0.1, 0.3, 1.0, 3.0, and 10.0 μM). Oxaliplatin (156–02,691; Wako, Tokyo, Japan) was added to the medium (to final concentrations of 0, 0.01, 0.1, 1.0, 10.0, and 100.0 μM). The cell growth reagent for the WST-1 assay was added (10 μL/well) and incubated for 30 min at 37 °C with 5% COtwo after a 48-h incubation with CPT and 24-h of oxaliplatin. The absorbance of cells between 420 and 480 nm against a blank and background control was measured using a Bio-Rad iMARK Microplate Reader (Bio-Rad Inc. Hercules, CA, USA).

Western blot analysis

Cells were lysed with radioimmunoprecipitation assay buffer without sodium dodecyl sulfate (SDS) [10 mM sodium phosphate (pH 7.2), 150 mM NaCl, 3 mM MgCl2, 2 mM EDTA, 1% NP-40, 1% sodium deoxycholate, 0.2 U/mL aprotinin, and phosphatase inhibitors] and briefly sonicated on ice. Debris were removed by sedimentation in a microcentrifuge at 16,400 × g for 10 min at 4 °C, and the cleared cell lysates were harvested and mixed with Laemmli sample buffer. Proteins (25 µg) from whole-cell lysates were loaded in each lane of an SDS–polyacrylamide gel, separated by electrophoresis, transferred onto polyvinylidene difluoride membranes (Merck Millipore), and visualized by immunoblotting with the indicated antibodies and enhanced chemiluminescence (GE Healthcare). , Provo, UT, USA). The relative intensities of protein expression were determined by Image J (http://rsb.info.nih.gov/ij/index.html). The relative ratio was calculated by comparing with the amount before CPT treatment. The ratio before CPT treatments was set as 1 in both the control and mSAT cells.

Statistical analyzes

All statistical analyzes were performed using GraphPad Prism (v.9.0; GraphPad Software, San Diego, CA, USA). When necessary, differences in qualitative variables were evaluated using either the χtwo test or Fisher’s exact test. Continuous variables were compared using analysis of variance with the Tukey–Kramer test, and the means or medians were compared with the paired samples. you-test for normally distributed variables. Dose–response curves with the responses normalized to the zero dose as a function of log concentration were generated and statistically compared using the sum-of-squares F test. The half-maximal inhibitory concentration (ICfifty) values ​​were obtained using a four-parameter logistic model. Statistical significance was set atp<0.05.

Leave a Reply

Your email address will not be published.